SequenceTrack class and methods

Source: R/SequenceTrack-class.R

A track class to represent genomic sequences. The three child classes SequenceDNAStringSetTrack, SequenceRNAStringSetTrack and SequenceBSgenomeTrack do most of the work, however in practise they are of no particular relevance to the user.

# S4 method for class 'SequenceTrack'
initialize(.Object, chromosome, genome, ...)

SequenceTrack(
  sequence,
  chromosome,
  genome,
  name = "SequenceTrack",
  importFunction,
  stream = FALSE,
  ...
)

RNASequenceTrack(
  sequence,
  chromosome,
  genome,
  name = "SequenceTrack",
  importFunction,
  stream = FALSE,
  ...
)

# S4 method for class 'SequenceTrack'
seqnames(x)

# S4 method for class 'SequenceBSgenomeTrack'
seqnames(x)

# S4 method for class 'SequenceTrack'
seqlevels(x)

# S4 method for class 'SequenceBSgenomeTrack'
seqlevels(x)

# S4 method for class 'SequenceTrack'
start(x)

# S4 method for class 'SequenceTrack'
end(x)

# S4 method for class 'SequenceTrack'
width(x)

# S4 method for class 'SequenceTrack'
length(x)

# S4 method for class 'SequenceTrack'
subseq(x, start = NA, end = NA, width = NA)

# S4 method for class 'ReferenceSequenceTrack'
subseq(x, start = NA, end = NA, width = NA)

# S4 method for class 'SequenceTrack'
chromosome(GdObject)

# S4 method for class 'SequenceTrack'
chromosome(GdObject) <- value

# S4 method for class 'SequenceTrack'
genome(x)

# S4 method for class 'SequenceTrack'
consolidateTrack(GdObject, chromosome, ...)

# S4 method for class 'SequenceTrack'
drawGD(GdObject, minBase, maxBase, prepare = FALSE, ...)

# S4 method for class 'SequenceBSgenomeTrack'
show(object)

# S4 method for class 'SequenceDNAStringSetTrack'
show(object)

# S4 method for class 'SequenceRNAStringSetTrack'
show(object)

# S4 method for class 'ReferenceSequenceTrack'
show(object)

Arguments

.Object

The object skeleton passed on by new() during class instantiation, to be filled in by the initialize method.

chromosome

The currently active chromosome, which may have to be set for a RangeTrack or a SequenceTrack object.

genome

The genome on which the track's ranges are defined. Usually this is a valid UCSC genome identifier, however this is not being formally checked at this point. For a SequenceBSgenomeTrack object, the genome information is extracted from the input BSgenome package. For a DNAStringSet it has to be provided, or the constructor will fall back to the default value of NA.

...

Additional items which will all be interpreted as further display parameters. See settings and the "Display Parameters" section below for details.

sequence

A meta argument to handle the different input types, making the construction of a SequenceTrack as flexible as possible.

The different input options for sequence are:

  • An object of class DNAStringSet: the individual DNAStrings are considered to be the different chromosome sequences.

  • An object of class BSgenome: the Gviz package tries to follow the BSgenome philosophy in that the respective chromosome sequences are only realized once they are first accessed.

  • A character scalar: the value of the sequence argument is considered to be a file path to an annotation file on disk. A range of file types are supported by the Gviz package as identified by the file extension. See the importFunction documentation below for further details.

name

Character scalar of the track's name used in the title panel when plotting.

importFunction

A user-defined function to be used to import the sequence data from a file. This only applies when the sequence argument is a character string with the path to the input data file. The function needs to accept an argument file containing the file path and has to return a proper DNAStringSet object with the sequence information per chromosome. A set of default import functions is already implemented in the package for a number of different file types, and one of these defaults will be picked automatically based on the extension of the input file name. If the extension cannot be mapped to any of the existing import functions, an error is raised asking for a user-defined import function. Currently the following file types can be imported with the default functions: fa/fasta and 2bit.

Both file types support indexing by genomic coordinates, and it makes sense to only load the part of the file that is needed for plotting. To this end, the Gviz package defines the derived ReferenceSequenceTrack class, which supports streaming data from the file system. The user typically does not have to deal with this distinction but may rely on the constructor function to make the right choice as long as the default import functions are used. However, once a user-defined import function has been provided and if this function adds support for indexed files, you will have to make the constructor aware of this fact by setting the stream argument to TRUE. Please note that in this case the import function needs to accept a second mandatory argument selection, which is a GRanges object containing the dimensions of the plotted genomic range. As before, the function has to return an appropriate DNAStringSet object.

stream

A logical flag indicating that the user-provided import function can deal with indexed files and knows how to process the additional selection argument when accessing the data on disk. This causes the constructor to return a ReferenceSequenceTrack object which will grab the necessary data on the fly during each plotting operation.

x

A valid track object class name, or the object itself, in which case the class is derived directly from it.

start, end, width

Integer scalars defining the requested subsequence. Exactly two of the three must be provided; the third is derived from them.

GdObject

Object of class GdObject.

value

Value to be set.

minBase

Numeric scalar, the start coordinate of the sequence.

maxBase

Numeric scalar, the end coordinate of the sequence.

prepare

logical. Run the drawing method in preparation rather than in production mode, i.e., only compute the track's layout without rendering anything to the device.

object

Object inheriting from SequenceTrack.

Value

The return value of the constructor function is a new object of class SequenceDNAStringSetTrack, SequenceBSgenomeTrack or ReferenceSequenceTrack, depending on the constructor arguments. Typically the user will not have to be troubled with this distinction and can rely on the constructor to make the right choice.

Functions

  • initialize(SequenceTrack): Initialize the display parameter defaults and the chromosome/genome slots before deferring to the GdObject initializer for the remaining slots.

  • SequenceTrack(): Constructor

  • RNASequenceTrack(): Constructor

  • seqnames(SequenceTrack): return the names (i.e., the chromosome) of the sequences contained in the object.

  • seqnames(SequenceBSgenomeTrack): return the names (i.e., the chromosome) of the sequences contained in the object.

  • seqlevels(SequenceTrack): return the names (i.e., the chromosome) of the sequences contained in the object. Only those with length > 0.

  • seqlevels(SequenceBSgenomeTrack): return the names (i.e., the chromosome) of the sequences contained in the object. Only those with length > 0.

  • start(SequenceTrack): return the start coordinates of the track items.

  • end(SequenceTrack): return the end coordinates of the track items.

  • width(SequenceTrack): return the with of the track items in genomic coordinates.

  • length(SequenceTrack): return the length of the sequence for active chromosome.

  • subseq(SequenceTrack): extract a subsequence for the active chromosome between start and end (or of the given width), padding with - outside the available sequence range. Two of start, end and width must be provided.

  • subseq(ReferenceSequenceTrack): extract a subsequence for the active chromosome by streaming the required region from the referenced file, rather than from an in-memory sequence.

  • chromosome(SequenceTrack): return the chromosome for which the track is defined.

  • chromosome(SequenceTrack) <- value: replace the value of the track's chromosome. This has to be a valid UCSC chromosome identifier or an integer or character scalar that can be reasonably coerced into one.

  • genome(SequenceTrack): Set the track's genome. Usually this has to be a valid UCSC identifier, however this is not formally enforced here.

  • consolidateTrack(SequenceTrack): Determine whether there are chromosome settings or not, and add this information.

  • drawGD(SequenceTrack): plot the object to a graphics device. The return value of this method is the input object, potentially updated during the plotting operation. Internally, there are two modes in which the method can be called. Either in 'prepare' mode, in which case no plotting is done but the object is preprocessed based on the available space, or in 'plotting' mode, in which case the actual graphical output is created. Since subsetting of the object can be potentially costly, this can be switched off in case subsetting has already been performed before or is not necessary.

  • show(SequenceBSgenomeTrack): Show method.

  • show(SequenceDNAStringSetTrack): Show method.

  • show(SequenceRNAStringSetTrack): Show method.

  • show(ReferenceSequenceTrack): Show method.

Objects from the class

Objects can be created using the constructor function SequenceTrack.

Author

Florian Hahne

Examples

## An empty object
SequenceTrack()
#> Sequence track 'SequenceTrack':
#> | genome: NA
#> | chromosomes: 0
#> | active chromosome: chrNA (0 nucleotides)

## Construct from DNAStringSet
library(Biostrings)
letters <- c("A", "C", "T", "G", "N")
set.seed(999)
seqs <- DNAStringSet(c(chr1 = paste(sample(letters, 100000, TRUE),
    collapse = ""
), chr2 = paste(sample(letters, 200000, TRUE), collapse = "")))
sTrack <- SequenceTrack(seqs, genome = "hg38")
sTrack
#> Sequence track 'SequenceTrack':
#> | genome: hg38
#> | chromosomes: 2
#> | active chromosome: chr1 (100000 nucleotides)
#> Call seqnames() to list all available chromosomes
#> Call chromosome()<- to change the active chromosome

## Construct from BSgenome object
if (require(BSgenome.Hsapiens.UCSC.hg38)) {
    sTrack <- SequenceTrack(Hsapiens)
    sTrack
}
#> Sequence track 'SequenceTrack':
#> | genome: hg38
#> | chromosomes: 711
#> | active chromosome: chr1 (248956422 nucleotides)
#> Call seqnames() to list all available chromosomes
#> Call chromosome()<- to change the active chromosome
#> Parent BSgenome object:
#> | organism: Homo sapiens
#> | provider: UCSC
#> | provider version: hg38
#> | release date: 2023/01/31
#> | package name: BSgenome.Hsapiens.UCSC.hg38


## Set active chromosome
chromosome(sTrack)
#> [1] "chr1"
chromosome(sTrack) <- "chr2"
head(seqnames(sTrack))
#> [1] "chr1" "chr2" "chr3" "chr4" "chr5" "chr6"

## Plotting
## Sequences
plotTracks(sTrack, from = 199970, to = 200000)

## Boxes
plotTracks(sTrack, from = 199800, to = 200000)

## Line
plotTracks(sTrack, from = 1, to = 200000)

## Force boxes
plotTracks(sTrack, from = 199970, to = 200000, noLetters = TRUE)

## Direction indicator
plotTracks(sTrack, from = 199970, to = 200000, add53 = TRUE)

## Sequence complement
plotTracks(sTrack,
    from = 199970, to = 200000, add53 = TRUE, complement = TRUE
)

## Colors
plotTracks(sTrack, from = 199970, to = 200000, add53 = TRUE, fontcolor = c(
    A = 1,
    C = 1, G = 1, T = 1, N = 1
))


## Track names
names(sTrack)
#> [1] "SequenceTrack"
names(sTrack) <- "foo"

## Accessors
genome(sTrack)
#> [1] "hg38"
genome(sTrack) <- "mm39"
length(sTrack)
#> [1] 242193529

## Sequence extraction
subseq(sTrack, start = 100000, width = 20)
#> 20-letter DNAString object
#> seq: TGTCCAAATATGTCTGGTGA
## beyond the stored sequence range
subseq(sTrack, start = length(sTrack), width = 20)
#> 20-letter DNAString object
#> seq: N-------------------